|
|
OligodDesign manual
Introduction
The OligoDesign system solves the problem of designing optimal DNA and
LNA modified oligonucleotides for detection of expressed genes, for use
in expression micro arrays.
The system takes the nucleotide sequence of the target gene as input,
and calculates a prioritized list of optimal oligonucleotides.
The OligoDesign system features LNA modified oligonucleotide
secondary structure prediction, LNA spiked oligonucleotide melting temperature
prediction, genome wide cross hybridization prediction, secondary
structure prediction of the target and recognition and filtering of
the target in the genome.
These features are determined for each possible probe of the query
gene and a score is calculated by a fuzzification of the value.
The fuzzification function is y=1/(1+exp(-k(c-x)) where k = slope, c = cutoff and x = property.
The fuzzy values are multiplied to give a final score.
Hereafter all oligonucleotides are ranked according to theire score and the
top scoring probes are returned.
Step by step guide to the succesfull design of an oligonucleotide
 Enter the target gene sequence.
 The sequence of the target gene
Enter the nucleotide sequence of the target gene, space and numbers
are ignored. The
nucleotides that can be used are : a, c, g and t.
The maximal sequence length is 10000nt.
Optionally a sequence name may be specified by providing the sequence in
fasta format e.g.:
>Z81127 C. elegans example
aaagtgactaacggaggatctcgccaattatctttgagagacaaaactgaaactccttat
ttaaatgcaacaattgcggaagtacaacgacatgcatccatcctcaatatcaatttttgg
cggatcaataatgagccaacagtaattggaggacatcctgtcgactcaggatgtttgatt
gcttcccaattgagtgctcttcatacaaatgagaaaatctttgaaaatcctgagaaattc
 Adjust the parameters.
database
Choose the pool of genes which the oligonucleotide might encounter during
the hybridization experiment, if the target gene is from
C. elegans choose c_elegans. The oligonucleotide will be selected
so as only to match
the target gene and none of the other genes. There are several
databases available.
length of the oligonucleotide
Specify the length of the oligonucleotide, the length of LNA spiked oligonucleotides can
be chosen shorter than for oligonucleotides witout LNA because LNA will increase
the energi of the hybridization. A typical length could be around 30 nt.
LNA frequency
Specify the frequency of LNA spiked nucleotides in the oligonucleotide.
A value of 3 will replace every third nucleotide with an LNA analog.
A value of 0 will result in oligonucleotides without LNA spiking, this is not
recomended because the hybridization properties of the oligonucleotide will suffer, from
the lack of LNA.
e.g.
AcgTgcGcgGta
LNA phase
Specify the phase of the LNA spiked nucleotides in the oligonucleotide.
A value of 0 will spike the first nucleotide of the oligonucleotide with LNA, and
then continue the spiking according to the frequency.
e.g.
0: AcgTgcGcgGta
1: aCgtGcgCggTa
dna only
Make dna only probes. Warning: not using LNA in your expression arrays may severely affect the
quality of your micro array experiments.
LNA end length
This number will spike the ends of the oligonucleotide with as many LNAs.
e.g.
3: ACGtgcgcgGTA
minimum distance between the oligonucleotides
Specify the minimum distance between neighbour oligonucleotides. This option
is usefull if more than one oligonucleotide is used for a single target gene, to
prevent the oligonucleotides from overlapping, or to ensure that they target different
parts of the gene.
blast word length
Select the wordlen used by blast.
search strand
Select which strand's of the database to search, for cDNA, the direct strand
will be sufficient, for genomes both strands must be searched.
blast expectation cutoff
Select the expectation cutoff used by blast. Higher is more sensitiv.
min tm
Select the minimal melting temperature desired for the oligonucleotides.
max tm
Select the maximal melting temperature desired for the oligonucleotides.
max. match percent
Maximal acceptable percentage sequence identity to other genes.
max. stretch percent
Maximal acceptable percentage identity to other genes without gaps.
position preference
Preferably place the oligonucleotide 3', 5' or anywhere.
Feature weight
weight of maximal match
weight of maximal stretch
weight of self hypridization
weight of secondary structure
weight of target structure
weight of Tm
weight of position preference
Select how much this contribution adds to the final score. To increase its
importance choose a higher value, a value of zero means that this feature
is ignored completely in the oligonucleotide design process.
The individual features are described under "details about the score" below.
 Submit the job to OligoDesign
Hit the submit button. The processing of the sequence
will take a few seconds and up to a few minutes depending
on the length of the sequence and the load of the server.
Hit the refresh button to see if the result is ready, or
wait until the page auto updates.
<< expression oligonucleotide design
How to read the result page
The proposed optimal oligonucleotide.
The oligonucleotide.
The sequence of the optimal oligonucleotide is shown, nucleotides that
have been spiked with LNA are shown with capital letters.
Below the oligonucleotide information regarding the quality of the
oligonucleotide are given, it is recomended to check this information
before accepting the oligonucleotide.
The oligonucleotide information might look like this:
AaaTgcAacAatTgcGgaAgtAcaAcgAca
seqno: 1 oligono: 1
score=0.43 , tm=0
start=62, end=92
The first line gives the sequence of the oligonucleotide.
The seqno is the sequence number (always 1).
The oligono is the oligonucleotide number, 1 is the first and
best oligonucleotide, 2 is the second best and so on.
The score is a number between 0 and 1, if all selection
criteria are perfectly fullfilled, the score will be close
to one.
Tm is the melting temperature of the oligonucleotide as found with
lna-tm.com,
The last line gives the position of the oligonucleotide in the target
sequence.
Show other hits.
The score indicates if there is any crosshybridization to other
genes in the genome, if there is no cross hybridization it is
close to one. The detailed view apears by checking the check box
and pressing the refresh button. Possible cross hybridizations
are shown. In the example below the cross hybridizations are
weak and not likely to pose any problem.
AaaTgcAacAatTgcGgaAgtAcaAcgAca
||||||| |||| ||| | ||||| || 22 matches
gaatgcaatgattggagaaattcaacgtca CHROMOSOME_V
|||||||||| 10 matches
aaatgcaaca CHROMOSOME_X
|||||||||| 10 matches
aaatgcaaca CHROMOSOME_X
||| 3 matches
aaa CHROMOSOME_X
Show the oligonucleotide secondary structure.
Possible secondary structure of the oligonucleotide is shown here,
a score close to one indicates that the secondary structure
is of little consequence.
AaaTgcAacAatTgcGgaAgtAcaAcgAca
((.(( )).))
Matching parenthesis show nucleotides that might bind to each
other, dots show non canonical bindings.
Show structure of the target sequence.
This score is low if the oligonucleotide matches within a strong secondary
structure of the target gene. Parts of the target gene that
are in strong secondary structures are marked with #
Show details about the score.
The score indicates to wich extend the oligonucleotide confirms to the
selection criteria, if it fits all criteria the score will
be close to one. The score is found by combining the scores of
the individual criteria in a neural network weighting sheme.
oligonucleotide score : 0.43
max_match 22 score= 0.97 x 1 ( 30 5 0.9)
max_stretch 10 score= 1.00 x 1 ( 20 2 0.9)
self_hyp 14 score= 0.92 x 1 ( 25 10 0.9)
target_struct 0 score= 0.96 x 1 ( 30 20 0.9)
tm 0 score= 0.00 x 5 ( 2 0.1 0.9)
tm_max 0 score= 0.00 x 1 ( 95 2 0.9)
tm_min 0 score= 0.00 x 1 ( 40 2 0.9)
The first line gives the combined score of the oligonucleotide.
The max_match line gives the maximal number of matching nucleotides found,
the score, the weight of the score, the threshold, and two numbers indicating
the slope of the threshold. The max_stretch is the longest continuous number
of matching nucleotides in the genome. The self hybridization score indicates
the entalpy change made by the secondary structure in the oligonucleotide. The target_struct
gives the how many nucleotides of the oligonucleotide lie within a strong secondary
structure of the target gene. There are three tm indicators, tm_min and tm_max
give the tm of the probe and a score indicating the distance to the
threshold, the tm value is the combined score.
Show table of oligonucleotides.
The table shows all the oligonucleotide suggestions found.
The columns are:
Sequence number, Oligo number, Oligonucleotide, Score, Tm, start, end
Use select and paste to transfer the data to other aplications e.g. Excel.
Select alternative oligonucleotide.
The oligonucleotide with the highest score is shown, alternative oligonucleotides can
be selected from the list.
|
